Stem-loop sequence eca-mir-302a

AccessionMI0012667 (change log)
DescriptionEquus caballus miR-302a stem-loop
Gene family MIPF0000071; mir-302
Literature search

3 open access papers mention eca-mir-302a
(3 sentences)

Stem-loop
   ccac    u         u           gaa 
5'     cacu aaacgugga guacuugcuuu   a
       |||| ||||||||| |||||||||||   c
3'     guga uuuguaccu cgugaaugaaa   u
   -gua    u         u           aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 113629373-113629440 [+]
antisense
ENSECAT00000001702 ; LARP7-201; intron 8
ENSECAT00000001915 ; LARP7-202; intron 8
Clustered miRNAs
< 10kb from eca-mir-302a
eca-mir-302bchr2: 113629063-113629138 [+]
eca-mir-302cchr2: 113629201-113629268 [+]
eca-mir-302achr2: 113629373-113629440 [+]
eca-mir-302dchr2: 113629533-113629600 [+]
eca-mir-367chr2: 113629662-113629729 [+]
Database links

Mature sequence eca-miR-302a

Accession MIMAT0012911
Sequence

44 - 

uaagugcuuccauguuuuaguga

 - 66

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).