Stem-loop sequence eca-mir-200b

AccessionMI0012666 (change log)
DescriptionEquus caballus miR-200b stem-loop
Gene family MIPF0000019; mir-8
Literature search

3 open access papers mention eca-mir-200b
(12 sentences)

Stem-loop
          c   cu   ug     c      u ugu 
5' gccgucg cau  uac  ggcag auugga g   c
   ||||||| |||  |||  ||||| |||||| |    
3' cggcagu gua  aug  ccguc uaaucu c   u
          a   --   gu     a      - ugg 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 48455071-48455139 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-200b
eca-mir-200bchr2: 48455071-48455139 [-]
eca-mir-200achr2: 48454404-48454493 [-]
eca-mir-3548chr2: 48454387-48454515 [+]
eca-mir-429chr2: 48453025-48453091 [-]
Database links

Mature sequence eca-miR-200b

Accession MIMAT0012910
Sequence

44 - 

uaauacugccugguaaugauga

 - 65

Get sequence
Deep sequencing40 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).