Stem-loop sequence eca-mir-200a

AccessionMI0012665 (change log)
DescriptionEquus caballus miR-200a stem-loop
Gene family MIPF0000019; mir-8
Literature search

2 open access papers mention eca-mir-200a
(11 sentences)

Stem-loop
   c    - c   g        -             c    uuuc     
5'  uggg c ccu ugggcauc uuaccggacagug ugga    ucgg 
    |||| | ||| |||||||| ||||||||||||| ||||    ||| c
3'  accc g gga acuuguag aauggucugucac aucu    agcu 
   c    a u   a        c             a    ---c     
Get sequence
Deep sequencing
35 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 48454404-48454493 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-200a
eca-mir-200bchr2: 48455071-48455139 [-]
eca-mir-200achr2: 48454404-48454493 [-]
eca-mir-3548chr2: 48454387-48454515 [+]
eca-mir-429chr2: 48453025-48453091 [-]
Database links

Mature sequence eca-miR-200a

Accession MIMAT0012909
Sequence

54 - 

uaacacugucugguaacgaugu

 - 75

Get sequence
Deep sequencing33 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).