Stem-loop sequence eca-mir-346

AccessionMI0012658 (change log)
DescriptionEquus caballus miR-346 stem-loop
Gene family MIPF0000188; mir-346
Stem-loop
   -g u      g ug    u    cu    -  aug        u  guug 
5'   g cucugu u  ggcg cugu  gccc gc   ccugccuc cu    c
     | |||||| |  |||| ||||  |||| ||   |||||||| ||     
3'   c gagacg g  ccgu gacg  cggg cg   ggacggag ga    u
   gg -      - gu    c    uc    u  --g        -  aguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 84117510-84117604 [+]
sense
ENSECAT00000029043 ; GRID1-202; intron 1
Database links

Mature sequence eca-miR-346

Accession MIMAT0012902
Sequence

20 - 

ugucugcccgcaugccugccucu

 - 42

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).