Stem-loop sequence eca-mir-208b

AccessionMI0012656 (change log)
DescriptionEquus caballus miR-208b stem-loop
Gene family MIPF0000178; mir-208
Literature search

3 open access papers mention eca-mir-208b
(10 sentences)

Stem-loop
   --c        g          c   cg        cu 
5'    cucucagg aagcuuuuug ucg  uuauguuu  c
      |||||||| |||||||||| |||  ||||||||  a
3'    gggagucu uuuggaaaac agc  aauauaag  u
   gac        g          a   ag        cc 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 161511731-161511807 [-]
sense
ENSECAT00000023357 ; MHC-1-201; intron 29
ENSECAT00000023389 ; MHC-1-202; intron 30
ENSECAT00000023469 ; MHC-1-203; intron 30
Database links

Mature sequence eca-miR-208b

Accession MIMAT0012900
Sequence

46 - 

auaagacgaacaaaagguuugu

 - 67

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).