Stem-loop sequence eca-mir-208a

AccessionMI0012655 (change log)
DescriptionEquus caballus miR-208a stem-loop
Gene family MIPF0000178; mir-208
Literature search

2 open access papers mention eca-mir-208a
(4 sentences)

Stem-loop
   u    g    g           g  c  gg      c  a 
5'  uccu ugac ggcgagcuuuu gc cg  uuauac ug u
    |||| |||| ||||||||||| || ||  |||||| || g
3'  agga acug uuguucgaaaa cg gc  aauaug ac c
   g    g    g           a  a  ag      c  u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 161483496-161483578 [-]
sense
ENSECAT00000022901 ; MYHC-ALPHA-201; intron 28
Database links

Mature sequence eca-miR-208a

Accession MIMAT0012899
Sequence

50 - 

auaagacgagcaaaaagcuugu

 - 71

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).