Stem-loop sequence eca-mir-1905a

AccessionMI0012653 (change log)
DescriptionEquus caballus miR-1905a stem-loop
Gene family MIPF0000753; mir-1905
Stem-loop
   g        -   au c     auc    c   c 
5'  ucugcugu ugg  g gcuug   gugg gcc u
    |||||||| |||  | |||||   |||| |||  
3'  ggauggcg acc  c cgagc   cacc cgg u
   g        c   au c     -ac    c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 89372940-89373007 [-]
antisense
ENSECAT00000014024 ; eca-mir-1905a-201; 3'UTR (exon 2)
Database links

Mature sequence eca-miR-1905a

Accession MIMAT0012897
Sequence

42 - 

caccacgagcccuaccacgcgguag

 - 66

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).