Stem-loop sequence eca-mir-184

AccessionMI0012650 (change log)
DescriptionEquus caballus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   acauc         c      ag     -    ug 
5'      uccuuauca uuuucc  ccagc uuug  a
        ||||||||| ||||||  ||||| ||||   
3'      gggaauagu aagagg  gguug gaau  c
   -ggau         c      ca     u    cu 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 115216736-115216805 [-]
intergenic
Database links

Mature sequence eca-miR-184

Accession MIMAT0012894
Sequence

46 - 

uggacggagaacugauaagggu

 - 67

Get sequence
Deep sequencing12 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).