Stem-loop sequence eca-mir-146b

AccessionMI0012648 (change log)
DescriptionEquus caballus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

4 open access papers mention eca-mir-146b
(31 sentences)

Stem-loop
     u   u  g        a    a    cu  ga  u 
5' cc ggc cu agaacuga uucc uagg  gu  gc c
   || ||| || |||||||| |||| ||||  ||  ||  
3' gg ccg gg ucuugacu aggg aucc  ua  cg c
     c   u  -        c    -    cg  aa  a 
Get sequence
Deep sequencing
38612 reads, 2.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 27716546-27716619 [-]
intergenic
Database links

Mature sequence eca-miR-146b-5p

Accession MIMAT0012891
Sequence

9 - 

ugagaacugaauuccauaggcu

 - 30

Get sequence
Deep sequencing38596 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-146b-3p

Accession MIMAT0012892
Sequence

46 - 

ugcccuagggacucaguucugg

 - 67

Get sequence
Deep sequencing15 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).