Stem-loop sequence eca-mir-1179

AccessionMI0012644 (change log)
DescriptionEquus caballus miR-1179 stem-loop
Gene family MIPF0000632; mir-1179
Stem-loop
   ---------        ---gaa         c        gu u ua 
5'          gaaaggga      gcauucuuu auugguug  g g  u
            ||||||||      ||||||||| ||||||||  | |   
3'          cuuuuccu      cguaggaga uaaccgac  c c  u
   ucgaucagu        auuuac         c        ug u cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 94578238-94578323 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-1179
eca-mir-1179chr1: 94578238-94578323 [-]
eca-mir-7-1chr1: 94574963-94575022 [-]
Database links

Mature sequence eca-miR-1179

Accession MIMAT0012887
Sequence

10 - 

aagcauucuuucauugguugg

 - 30

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).