Stem-loop sequence rno-mir-496

AccessionMI0012622 (change log)
DescriptionRattus norvegicus miR-496 stem-loop
Gene family MIPF0000018; mir-154
Literature search

3 open access papers mention rno-mir-496
(4 sentences)

Stem-loop
        u    u        u     gu         uua 
5' agugu cgaa ggagguug ccaug  guguucauu   u
   ||||| |||| |||||||| |||||  |||||||||    
3' ucacg gcuu ccucuaac gguac  uaugaguag   u
        -    u        c     au         uau 
Get sequence
Deep sequencing
31892 reads, 18.7 reads per million, 347 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133889283-133889361 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-496
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
rno-mir-3072chr6: 133898795-133898905 [+]
Database links

Mature sequence rno-miR-496-5p

Accession MIMAT0017372
Previous IDsrno-miR-496*
Sequence

14 - 

agguuguccaugguguguuc

 - 33

Get sequence
Deep sequencing91 reads, 52 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-496-3p

Accession MIMAT0012860
Previous IDsrno-miR-496
Sequence

49 - 

aguauuacauggccaaucucc

 - 69

Get sequence
Deep sequencing31801 reads, 347 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).