Stem-loop sequence rno-mir-666

AccessionMI0012617 (change log)
DescriptionRattus norvegicus miR-666 stem-loop
Gene family MIPF0000782; mir-666
Literature search

2 open access papers mention rno-mir-666
(9 sentences)

Stem-loop
      -au  --ug    c   -        --a  -     gag      -  ag 
5' cug   uc    ccug gug gagcgggc   cg gcugu   agcccc cu  g
   |||   ||    |||| ||| ||||||||   || |||||   |||||| ||   
3' gac   ag    ggac cgc cucguccg   gu cgacg   ucgggg ga  u
      agc  ugaa    a   a        cua  g     ---      c  ca 
Get sequence
Deep sequencing
25697 reads, 2.52 reads per million, 317 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133866523-133866621 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-666
rno-mir-379chr6: 133857700-133857784 [+]
rno-mir-411chr6: 133858849-133858924 [+]
rno-mir-299bchr6: 133859295-133859412 [-]
rno-mir-299achr6: 133859324-133859386 [+]
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
Database links

Mature sequence rno-miR-666-5p

Accession MIMAT0012855
Previous IDsrno-miR-666
Sequence

19 - 

agcgggcacggcugugagag

 - 38

Get sequence
Deep sequencing7246 reads, 228 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-666-3p

Accession MIMAT0017371
Previous IDsrno-miR-666*
Sequence

56 - 

ggcugcagcgugaucgccugcuc

 - 78

Get sequence
Deep sequencing18437 reads, 300 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).