Stem-loop sequence rno-mir-667

AccessionMI0012614 (change log)
DescriptionRattus norvegicus miR-667 stem-loop
Gene family MIPF0000794; mir-667
Literature search

4 open access papers mention rno-mir-667
(9 sentences)

Stem-loop
         --acu     c  u     u ga    -  ag    ccauac 
5' gugggu     ggccu gg gcugg g  gcag ug  cacg      a
   ||||||     ||||| || ||||| |  |||| ||  ||||       
3' cacccg     ccgga cc cgacc c  cguc ac  gugu      u
         gaucc     a  -     - ac    c  -a    cuauau 
Get sequence
Deep sequencing
51828 reads, 20.2 reads per million, 332 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133869570-133869661 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-667
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
Database links

Mature sequence rno-miR-667-5p

Accession MIMAT0017369
Previous IDsrno-miR-667*
Sequence

15 - 

cggugcugguggagcagugagcac

 - 38

Get sequence
Deep sequencing1315 reads, 134 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-667-3p

Accession MIMAT0012852
Previous IDsrno-miR-667
Sequence

56 - 

ugacaccugccacccagcccaa

 - 77

Get sequence
Deep sequencing50502 reads, 331 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).