Stem-loop sequence rno-mir-465

AccessionMI0012612 (change log)
DescriptionRattus norvegicus miR-465 stem-loop
Gene family MIPF0000384; mir-465
Literature search

6 open access papers mention rno-mir-465
(13 sentences)

Stem-loop
   --u  ag   c          c  ug     gu   ga 
5'    gc  ugc cuauuuagaa gg  cuggu  gau  a
      ||  ||| |||||||||| ||  |||||  |||  u
3'    cg  aug gaugagucuu cc  gacua  uug  g
   auu  ga   a          u  gu     gu   aa 
Get sequence
Deep sequencing
484 reads, 5.88 reads per million, 34 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 151297367-151297443 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-465
rno-mir-465chrX: 151297367-151297443 [-]
rno-mir-3580chrX: 151295615-151295695 [-]
rno-mir-871chrX: 151287787-151287863 [-]
Database links

Mature sequence rno-miR-465-5p

Accession MIMAT0012850
Previous IDsrno-miR-465
Sequence

11 - 

uauuuagaacggugcuggugug

 - 32

Get sequence
Deep sequencing256 reads, 23 experiments
Evidence not experimental
Predicted targets

Mature sequence rno-miR-465-3p

Accession MIMAT0017367
Previous IDsrno-miR-465*
Sequence

45 - 

ugaucagugccuuucugaguag

 - 66

Get sequence
Deep sequencing223 reads, 23 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).