Stem-loop sequence rno-mir-295-1

AccessionMI0012611 (change log)
Previous IDsrno-mir-295
DescriptionRattus norvegicus miR-295-1 stem-loop
Gene family MIPF0000068; mir-290
Literature search

3 open access papers mention rno-mir-295-1
(8 sentences)

Stem-loop
   --   uuu  u  g       u    -     ac     - au 
5'   cau   gg ga acucaaa gugg ggcac  uucug g  u
     |||   || || ||||||| |||| |||||  ||||| |   
3'   gug   cc cu uggguuu cauc ucgug  aagau c  a
   gg   --u  u  g       u    a     -a     g gu 
Get sequence
Deep sequencing
226 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 64536623-64536703 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-295-1
rno-mir-290chr1: 64538705-64538785 [-]
rno-mir-291achr1: 64538407-64538488 [-]
rno-mir-292chr1: 64538119-64538200 [-]
rno-mir-291bchr1: 64537831-64537938 [-]
rno-mir-293chr1: 64537107-64537178 [-]
rno-mir-294chr1: 64536746-64536816 [-]
rno-mir-295-1chr1: 64536623-64536703 [-]
Database links

Mature sequence rno-miR-295-5p

Accession MIMAT0012849
Previous IDsrno-miR-295
Sequence

13 - 

acucaaauguggggcacacuucu

 - 35

Get sequence
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-295-3p

Accession MIMAT0017366
Previous IDsrno-miR-295*
Sequence

50 - 

aagugcuacuacuuuugggugu

 - 71

Get sequence
Deep sequencing450 reads, 49 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).