Stem-loop sequence rno-mir-294

AccessionMI0012610 (change log)
DescriptionRattus norvegicus miR-294 stem-loop
Gene family MIPF0000068; mir-290
Literature search

6 open access papers mention rno-mir-294
(29 sentences)

Stem-loop
   a    c    u            c  a   aa   u 
5'  uagc augc caaaauggaggc cu ucu  gcu u
    |||| |||| |||||||||||| || |||  |||  
3'  gucg ugug guuuuaccuucg ga aga  uga u
   -    u    u            u  a   --   a 
Get sequence
Deep sequencing
398 reads, 0 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 64536746-64536816 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-294
rno-mir-290chr1: 64538705-64538785 [-]
rno-mir-291achr1: 64538407-64538488 [-]
rno-mir-292chr1: 64538119-64538200 [-]
rno-mir-291bchr1: 64537831-64537938 [-]
rno-mir-293chr1: 64537107-64537178 [-]
rno-mir-294chr1: 64536746-64536816 [-]
rno-mir-295-1chr1: 64536623-64536703 [-]
Database links

Mature sequence rno-miR-294

Accession MIMAT0012848
Sequence

10 - 

cucaaaauggaggcccuaucu

 - 30

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).