Stem-loop sequence rno-mir-293

AccessionMI0012609 (change log)
DescriptionRattus norvegicus miR-293 stem-loop
Gene family MIPF0000068; mir-290
Literature search

4 open access papers mention rno-mir-293
(4 sentences)

Stem-loop
   --cu        -      g    a      g    u 
5'     gugauacu caaacu ugug cacuuu uuuc u
       |||||||| |||||| |||| |||||| ||||  
3'     cauuguga guuuga acgc gugaag aagg u
   uagc        c      a    c      -    u 
Get sequence
Deep sequencing
2214 reads, 2.14 reads per million, 140 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 64537107-64537178 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-293
rno-mir-290chr1: 64538705-64538785 [-]
rno-mir-291achr1: 64538407-64538488 [-]
rno-mir-292chr1: 64538119-64538200 [-]
rno-mir-291bchr1: 64537831-64537938 [-]
rno-mir-293chr1: 64537107-64537178 [-]
rno-mir-294chr1: 64536746-64536816 [-]
rno-mir-295-1chr1: 64536623-64536703 [-]
Database links

Mature sequence rno-miR-293-5p

Accession MIMAT0012847
Previous IDsrno-miR-293
Sequence

8 - 

acucaaacugugugacacuuu

 - 28

Get sequence
Deep sequencing2196 reads, 139 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-293-3p

Accession MIMAT0017365
Previous IDsrno-miR-293*
Sequence

44 - 

agugccgcaaaguuugcagugu

 - 65

Get sequence
Deep sequencing17 reads, 14 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).