Stem-loop sequence rno-mir-201

AccessionMI0012608 (change log)
DescriptionRattus norvegicus miR-201 stem-loop
Gene family MIPF0000386; mir-743
Literature search

3 open access papers mention rno-mir-201
(5 sentences)

Stem-loop
   --     g   -  c  u   u     a      uuc   a 
5'   guaca uac cu ac cag aaggc uuguuc   uau c
     ||||| ||| || || ||| ||||| ||||||   |||  
3'   cgugu aug ga ug guc uuccg gacaag   aua u
   aa     a   c  -  u   u     c      uaa   a 
Get sequence
Deep sequencing
39681 reads, 175 reads per million, 383 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 155339140-155339219 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-201
rno-mir-547chrX: 155338841-155338921 [+]
rno-mir-201chrX: 155339140-155339219 [+]
rno-mir-3585chrX: 155344176-155344293 [+]
Database links

Mature sequence rno-miR-201-5p

Accession MIMAT0012846
Previous IDsrno-miR-201
Sequence

12 - 

cacucaguaaggcauuguuc

 - 31

Get sequence
Deep sequencing35900 reads, 378 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-201-3p

Accession MIMAT0017364
Previous IDsrno-miR-201*
Sequence

47 - 

ugaacagcgccuuucuguguag

 - 68

Get sequence
Deep sequencing3781 reads, 226 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).