Stem-loop sequence rno-mir-802

AccessionMI0012602 (change log)
DescriptionRattus norvegicus miR-802 stem-loop
Gene family MIPF0000353; mir-802
Stem-loop
   -----guc      u     g c   a          a   uu    c au 
5'         cuauua uugca u agu acaaagauuc ucc  gugu g  c
           |||||| ||||| | ||| |||||||||| |||  |||| |   
3'         gauaau aaugu a uca uguuucugag agg  cacg c  a
   ccacuucc      u     g c   c          -   --    a au 
Get sequence
Deep sequencing
132394 reads, 155 reads per million, 375 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 33570256-33570351 [+]
intergenic
Database links

Mature sequence rno-miR-802-5p

Accession MIMAT0012840
Previous IDsrno-miR-802
Sequence

17 - 

ucaguaacaaagauucauccu

 - 37

Get sequence
Deep sequencing88746 reads, 344 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-802-3p

Accession MIMAT0017362
Previous IDsrno-miR-802*
Sequence

55 - 

acggagagucuuugucacucagu

 - 77

Get sequence
Deep sequencing43646 reads, 311 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).