Stem-loop sequence rno-mir-668

AccessionMI0012601 (change log)
DescriptionRattus norvegicus miR-668 stem-loop
Gene family MIPF0000357; mir-668
Literature search

3 open access papers mention rno-mir-668
(6 sentences)

Stem-loop
   --    a   u   ---        g            
5'   ggua gug gcc   ucggguga caugcacuuaa 
     |||| ||| |||   |||||||| |||||||||| c
3'   ccau cac cgg   ggcucacu guauguggaug 
   ac    -   c   cuc        -            
Get sequence
Deep sequencing
22298 reads, 3.64 reads per million, 302 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133885141-133885208 [+]
sense
ENSRNOT00000062113 ; Mir668-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-668
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
Database links

Mature sequence rno-miR-668

Accession MIMAT0012839
Sequence

43 - 

ugucacucggcucggcccacuacc

 - 66

Get sequence
Deep sequencing22249 reads, 302 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).