Stem-loop sequence rno-mir-615

AccessionMI0012597 (change log)
DescriptionRattus norvegicus miR-615 stem-loop
Gene family MIPF0000342; mir-615
Literature search

3 open access papers mention rno-mir-615
(3 sentences)

Stem-loop
   uc    -    c          uc     u        cu    g ug 
5'   ggga gggg gggagggggg  cccgg gcucggau  cgag g  c
     |||| |||| ||||||||||  ||||| ||||||||  |||| |  u
3'   cccu cccc ccuucucccu  ggguc cgagccug  gcuu u  u
   --    a    -          cu     -        --    g ua 
Get sequence
Deep sequencing
35768 reads, 0.251 reads per million, 399 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 144629019-144629110 [+]
sense
ENSRNOT00000022247 ; Hoxc5-201; intron 1
Database links

Mature sequence rno-miR-615

Accession MIMAT0012835
Sequence

17 - 

ggggguccccggugcucggauc

 - 38

Get sequence
Deep sequencing921 reads, 204 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).