Stem-loop sequence rno-mir-582

AccessionMI0012595 (change log)
DescriptionRattus norvegicus miR-582 stem-loop
Gene family MIPF0000417; mir-582
Literature search

5 open access papers mention rno-mir-582
(5 sentences)

Stem-loop
   -----         aua            ca     uaaucu 
5'      acucuuugg   caguuguucaac  guuac      a
        |||||||||   ||||||||||||  |||||       
3'      ugggaaacc   gucaacaaguug  caaug      a
   aaacg         caa            uc     uuaauc 
Get sequence
Deep sequencing
180032 reads, 67.8 reads per million, 488 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 40863750-40863830 [+]
sense
ENSRNOT00000073552 ; Pde4d-201; intron 1
Database links

Mature sequence rno-miR-582-5p

Accession MIMAT0012833
Previous IDsrno-miR-582
Sequence

11 - 

uacaguuguucaaccaguuacu

 - 32

Get sequence
Deep sequencing21857 reads, 428 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-582-3p

Accession MIMAT0017360
Previous IDsrno-miR-582*
Sequence

48 - 

aaccuguugaacaacugaaccc

 - 69

Get sequence
Deep sequencing158175 reads, 487 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).