Stem-loop sequence rno-mir-544

AccessionMI0012593 (change log)
DescriptionRattus norvegicus miR-544 stem-loop
Gene family MIPF0000436; mir-544
Stem-loop
   ---   cua    u           -     u   gauug 
5'    cac   ggga cuuguuaaaaa gcaga ucu     a
      |||   |||| ||||||||||| ||||| |||     g
3'    gug   cucu gaacgauuuuu cgucu aga     g
   gua   -aa    c           a     u   accag 
Get sequence
Deep sequencing
487 reads, 0 reads per million, 122 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133879169-133879246 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-544
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
Database links

Mature sequence rno-miR-544-5p

Accession MIMAT0017359
Previous IDsrno-miR-544*
Sequence

12 - 

cuuguuaaaaagcagauucu

 - 31

Get sequence
Deep sequencing78 reads, 40 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-544-3p

Accession MIMAT0012831
Previous IDsrno-miR-544
Sequence

47 - 

auucugcauuuuuagcaagcu

 - 67

Get sequence
Deep sequencing386 reads, 112 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).