Stem-loop sequence rno-mir-504

AccessionMI0012592 (change log)
DescriptionRattus norvegicus miR-504 stem-loop
Gene family MIPF0000437; mir-504
Literature search

5 open access papers mention rno-mir-504
(52 sentences)

Stem-loop
   ---    -            g     a    -g    gaa 
5'    cugu ugggagacccug ucugc cucu  ucug   a
      |||| |||||||||||| ||||| ||||  ||||    
3'    gaca acccuuugggac ggacg gagg  agac   c
   gga    u            g     a    ga    auu 
Get sequence
Deep sequencing
50374 reads, 13.3 reads per million, 428 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rno-miR-504

Accession MIMAT0012830
Sequence

9 - 

agacccuggucugcacucuguc

 - 30

Get sequence
Deep sequencing50074 reads, 428 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).