Stem-loop sequence rno-mir-511

AccessionMI0012591 (change log)
DescriptionRattus norvegicus miR-511 stem-loop
Gene family MIPF0000807; mir-511
Literature search

5 open access papers mention rno-mir-511
(11 sentences)

Stem-loop
   --   a    -  a  c        cu    ucag    uaa 
5'   gau ccca cc ug cuuuugcu  gcac    uaca   u
     ||| |||| || || ||||||||  ||||    ||||    
3'   cua gggu gg ac gaaaacga  ugug    gugu   c
   ac   g    a  -  a        --    -uaa    uua 
Get sequence
Deep sequencing
4508 reads, 0.254 reads per million, 394 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 81382966-81383044 [+]
sense
ENSRNOT00000024736 ; Mrc1-201; intron 5
Database links

Mature sequence rno-miR-511-5p

Accession MIMAT0012829
Previous IDsrno-miR-511
Sequence

10 - 

caugccuuuugcucugcacuc

 - 30

Get sequence
Deep sequencing843 reads, 247 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-511-3p

Accession MIMAT0017358
Previous IDsrno-miR-511*
Sequence

49 - 

aauguguagcaaaagacagga

 - 69

Get sequence
Deep sequencing3665 reads, 372 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).