Stem-loop sequence rno-mir-1224

AccessionMI0012589 (change log)
DescriptionRattus norvegicus miR-1224 stem-loop
Gene family MIPF0000440; mir-1224
Literature search

6 open access papers mention rno-mir-1224
(18 sentences)

Stem-loop
   g      cu          ------    u   accau      c 
5'  ugagga  ggggaggugg      aggg agu     uagagc a
    ||||||  ||||||||||      |||| |||     ||||||  
3'  acuccu  cuucuccacc      uccc ucg     gucucg g
   g      cu          ccccuc    -   acucu      a 
Get sequence
Deep sequencing
17427 reads, 4.84 reads per million, 248 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 83992628-83992712 [-]
sense
ENSRNOT00000037612 ; Vwa5b2-201; intron 22
Database links

Mature sequence rno-miR-1224

Accession MIMAT0012827
Sequence

1 - 

gugaggacuggggagguggag

 - 21

Get sequence
Deep sequencing17020 reads, 244 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).