Stem-loop sequence rno-mir-490

AccessionMI0012585 (change log)
DescriptionRattus norvegicus miR-490 stem-loop
Gene family MIPF0000229; mir-490
Literature search

8 open access papers mention rno-mir-490
(29 sentences)

Stem-loop
   uggaaaguucauugu      c      --         g   cac  uua 
5'                ucgaca caugga  ucuccaggu ggu   gu   g
                  |||||| ||||||  ||||||||| |||   ||    
3'                aguugu guaccu  ggaggucca cca   ca   a
   ---------------      c      ca         a   ---  uau 
Get sequence
Deep sequencing
90855 reads, 45.2 reads per million, 420 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 63342943-63343026 [+]
intergenic
Database links

Mature sequence rno-miR-490-5p

Accession MIMAT0017356
Previous IDsrno-miR-490*
Sequence

22 - 

ccauggaucuccaggugggu

 - 41

Get sequence
Deep sequencing2295 reads, 227 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-490-3p

Accession MIMAT0012823
Previous IDsrno-miR-490
Sequence

59 - 

caaccuggaggacuccaugcug

 - 80

Get sequence
Deep sequencing88559 reads, 420 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).