Stem-loop sequence oan-mir-182

AccessionMI0012558 (change log)
DescriptionOrnithorhynchus anatinus miR-182 stem-loop
Gene family MIPF0000116; mir-182
Stem-loop
   -----------     cu      u       u -g      uca      ugaggu 
5'            cccuc  gcugug uuggcaa g  uagaac   cacugg      a
              |||||  |||||| ||||||| |  ||||||   ||||||       
3'            gggag  cgguau aaccguu c  aucuug   guggcc      a
   acggccgacuc     cc      c       - ag      ---      uagggu 
Get sequence
Deep sequencing
7676 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
10: 4559452-4559551 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-182
oan-mir-18310: 4569067-4569197 [-]
oan-mir-9610: 4568763-4568871 [-]
oan-mir-18210: 4559452-4559551 [-]
Database links

Mature sequence oan-miR-182-5p

Accession MIMAT0012798
Sequence

14 - 

uuuggcaaugguagaacucaca

 - 35

Get sequence
Deep sequencing7674 reads, 5 experiments
Evidence experimental; Illumina [2]

Mature sequence oan-miR-182-3p

Accession MIMAT0026955
Sequence

59 - 

gguucuagacuugccaacua

 - 78

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).