Stem-loop sequence mml-mir-670

AccessionMI0012549 (change log)
DescriptionMacaca mulatta miR-670 stem-loop
Gene family MIPF0000734; mir-670
Stem-loop
   ---  u  -ac      uc        u     - ug    ug au 
5'    gg gg   cugaug  ccugagug augug g  aacc  a  u
      || ||   ||||||  |||||||| ||||| |  ||||  |  u
3'    cc cc   gacugu  ggacuuac uauac c  uugg  u  g
   cuu  -  guu      ga        u     u cu    gu cc 
Get sequence
Deep sequencing
203 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 22471659-22471747 [-]
sense
ENSMMUT00000001214 ; TTC17-201; intron 6
ENSMMUT00000001215 ; TTC17-202; intron 18
Database links

Mature sequence mml-miR-670-5p

Accession MIMAT0012792
Sequence

14 - 

ucccugaguguauguggugaa

 - 34

Get sequence
Deep sequencing80 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-670-3p

Accession MIMAT0026954
Sequence

52 - 

uuuccucauauucauucagg

 - 71

Get sequence
Deep sequencing119 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).