Stem-loop sequence mml-mir-543

AccessionMI0012544 (change log)
DescriptionMacaca mulatta miR-543 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
         u  u       u  -     ucuu     - uuu 
5' gguacu aa gagaagu gc ccgug    uuucg c   a
   |||||| || ||||||| || |||||    ||||| |   u
3' cuauga uu uucuuca cg ggcgc    aaagc g   u
         c  u       -  u     uuac     a ugu 
Get sequence
Deep sequencing
573 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163366417-163366496 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-543
mml-mir-379chr7: 163357370-163357436 [+]
mml-mir-411chr7: 163358629-163358710 [+]
mml-mir-299chr7: 163359095-163359157 [+]
mml-mir-380chr7: 163360318-163360378 [+]
mml-mir-323achr7: 163361034-163361119 [+]
mml-mir-758chr7: 163361327-163361414 [+]
mml-mir-329-1chr7: 163362091-163362174 [+]
mml-mir-329-2chr7: 163362410-163362489 [+]
mml-mir-494chr7: 163364071-163364151 [+]
mml-mir-543chr7: 163366417-163366496 [+]
mml-mir-495chr7: 163368266-163368347 [+]
mml-mir-376cchr7: 163373697-163373762 [+]
mml-mir-376a-2chr7: 163374075-163374154 [+]
mml-mir-654chr7: 163374225-163374305 [+]
mml-mir-376bchr7: 163374442-163374541 [+]
mml-mir-376a-1chr7: 163374788-163374855 [+]
Database links

Mature sequence mml-miR-543-5p

Accession MIMAT0026953
Sequence

13 - 

gaaguugcccgugucuuuuucg

 - 34

Get sequence
Deep sequencing48 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-543-3p

Accession MIMAT0012787
Sequence

49 - 

aaacauucgcggugcacuucuu

 - 70

Get sequence
Deep sequencing524 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).