Stem-loop sequence mml-mir-541

AccessionMI0012541 (change log)
DescriptionMacaca mulatta miR-541 stem-loop
Gene family MIPF0000213; mir-541
Stem-loop
   -   -u     aaa        c    g uc    u   aagug 
5'  acg  caggg   ggauucug uguc g  ccac cca     c
    |||  |||||   |||||||| |||| |  |||| |||      
3'  ugu  gucuc   ccuaagac acgg u  ggug ggu     a
   g   uc     agg        -    g --    -   aagau 
Get sequence
Deep sequencing
2245 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163398288-163398371 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-541
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
mml-mir-369chr7: 163399393-163399462 [+]
mml-mir-410chr7: 163399706-163399785 [+]
mml-mir-656chr7: 163400519-163400596 [+]
Database links

Mature sequence mml-miR-541-5p

Accession MIMAT0012784
Sequence

10 - 

aaaggauucugcugucggucccacu

 - 34

Get sequence
Deep sequencing1209 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-541-3p

Accession MIMAT0026951
Sequence

54 - 

uggugggcacagaauccggacu

 - 75

Get sequence
Deep sequencing1035 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).