Stem-loop sequence mml-mir-603

AccessionMI0012538 (change log)
DescriptionMacaca mulatta miR-603 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   gauugaugc      u    ucc           ug   cu       ua 
5'          uguugg uugg   aaaaguaauug  gug  ugccguu  u
            |||||| ||||   |||||||||||  |||  |||||||  a
3'          auaauu aauc   uuuucauuaac  cac  acgguaa  a
   ---------      c    ucu           gu   ac       ug 
Get sequence
Deep sequencing
127 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 24449100-24449193 [+]
sense
ENSMMUT00000011716 ; KIAA1217-201; intron 1
Database links

Mature sequence mml-miR-603

Accession MIMAT0012781
Sequence

61 - 

cacacacugcaauuacuuuuuc

 - 82

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).