Stem-loop sequence mml-mir-524

AccessionMI0012534 (change log)
DescriptionMacaca mulatta miR-524 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   --   u        c  a      c          ---    gu 
5'   uca gcugugac cu caaagg aagcacuuuc   ucuu  c
     ||| |||||||| || |||||| ||||||||||   ||||   
3'   agu uggcauug ga guuucc uucguggaag   agaa  u
   ag   u        u  c      c          aaa    aa 
Get sequence
Deep sequencing
223 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49057948-49058032 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-524
mml-mir-518bchr19: 49048495-49048577 [+]
mml-mir-518cchr19: 49056071-49056171 [+]
mml-mir-524chr19: 49057948-49058032 [+]
mml-mir-517achr19: 49059963-49060048 [+]
mml-mir-519dchr19: 49061111-49061201 [+]
mml-mir-518a-1chr19: 49066416-49066502 [+]
Database links

Mature sequence mml-miR-524-5p

Accession MIMAT0012777
Sequence

14 - 

cuacaaaggcaagcacuuucuc

 - 35

Get sequence
Deep sequencing193 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-524-3p

Accession MIMAT0026950
Sequence

51 - 

gaaggugcuucccuuugcagug

 - 72

Get sequence
Deep sequencing30 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).