Stem-loop sequence mml-mir-526b

AccessionMI0012533 (change log)
DescriptionMacaca mulatta miR-526b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
              c     u                -g    c 
5' ucaggcuguga ccucu gagggaagcacuuucu  uugu u
   ||||||||||| ||||| ||||||||||||||||  ||||  
3' agucuggcauu ggaga uuuccuucgugaaaga  aaua g
              c     u                aa    a 
Get sequence
Deep sequencing
923 reads, 75 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49038951-49039033 [+]
sense
ENSMMUT00000022596 ; 3'UTR (exon 4)
Clustered miRNAs
< 10kb from mml-mir-526b
mml-mir-519cchr19: 49030112-49030198 [+]
mml-mir-1283chr19: 49032979-49033088 [+]
mml-mir-520achr19: 49034604-49034688 [+]
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
mml-mir-525chr19: 49042145-49042230 [+]
mml-mir-523achr19: 49042991-49043077 [+]
mml-mir-518fchr19: 49044960-49045046 [+]
mml-mir-519achr19: 49046135-49046219 [+]
mml-mir-518bchr19: 49048495-49048577 [+]
Database links

Mature sequence mml-miR-526b

Accession MIMAT0012776
Sequence

14 - 

cucuugagggaagcacuuucugu

 - 36

Get sequence
Deep sequencing49 reads, 3 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).