Stem-loop sequence mml-mir-129-2

AccessionMI0012532 (change log)
DescriptionMacaca mulatta miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Literature search

1 open access papers mention mml-mir-129-2
(1 sentences)

Stem-loop
   cu             -       c   cu      ---     acau 
5'   gcccuucgugaau cuuuuug ggu  gggcuu   gcugu    a
     ||||||||||||| ||||||| |||  ||||||   |||||     
3'   cgggaggcgcuua gaaaaac cca  cccgaa   cgaua    a
   cg             c       c   uu      ggc     acuc 
Get sequence
Deep sequencing
278087 reads, 1.39e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 22449808-22449899 [-]
sense
ENSMMUT00000001214 ; TTC17-201; intron 10
Database links

Mature sequence mml-miR-129-5p

Accession MIMAT0006185
Sequence

16 - 

cuuuuugcggucugggcuugc

 - 36

Get sequence
Deep sequencing492165 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-129-2-3p

Accession MIMAT0031083
Sequence

58 - 

aagcccuuaccccaaaaagca

 - 78

Get sequence
Deep sequencing31778 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).