Stem-loop sequence mmu-mir-432

AccessionMI0012528 (change log)
Symbol MGI:Mir432
DescriptionMus musculus miR-432 stem-loop
Gene family MIPF0000211; mir-432
Literature search

9 open access papers mention mmu-mir-432
(12 sentences)

Stem-loop
   ug   a    -   --cau    ---u     -  -    c 
5'   ggu gcuc uug     uucc    ggugg gg gcca u
     ||| |||| |||     ||||    ||||| || |||| g
3'   ucg cggg gac     gagg    ucacc cc cggu g
   --   a    u   uagau    uucu     u  u    a 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109594956-109595030 [+]
antisense
ENSMUST00000149046 ; Rtl1-201; exon 2
Clustered miRNAs
< 10kb from mmu-mir-432
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
mmu-mir-431chr12: 109590447-109590537 [+]
mmu-mir-433chr12: 109591715-109591838 [+]
mmu-mir-127chr12: 109592846-109592915 [+]
mmu-mir-434chr12: 109594506-109594599 [+]
mmu-mir-432chr12: 109594956-109595030 [+]
mmu-mir-3071chr12: 109595318-109595397 [-]
mmu-mir-136chr12: 109595327-109595388 [+]
Database links

Mature sequence mmu-miR-432

Accession MIMAT0012771
Sequence

51 - 

ucuuggaguagaucagugggcag

 - 73

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0003133
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).