Stem-loop sequence mdo-mir-875

AccessionMI0012523 (change log)
DescriptionMonodelphis domestica miR-875 stem-loop
Gene family MIPF0000424; mir-875
Stem-loop
     u    u  aau        c  a       uuaa 
5' uc gugg ac   accucagu uu ucaggug    u
   || |||| ||   |||||||| || |||||||    u
3' ag cacu ug   uggagucg aa gguccac    a
     u    u  cgu        u  a       uaaa 
Get sequence
Deep sequencing
70 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 364601417-364601491 [-]
antisense
ENSMODT00000008123 ; VPS13B-201; intron 29
Clustered miRNAs
< 10kb from mdo-mir-875
mdo-mir-875chr3: 364601417-364601491 [-]
mdo-mir-599chr3: 364601260-364601342 [-]
Database links

Mature sequence mdo-miR-875-5p

Accession MIMAT0012766
Sequence

12 - 

auaccucagucuuaucaggug

 - 32

Get sequence
Deep sequencing68 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-875-3p

Accession MIMAT0026949
Sequence

48 - 

uggaaaugcugagguugcgu

 - 67

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).