Stem-loop sequence mdo-mir-599

AccessionMI0012522 (change log)
DescriptionMonodelphis domestica miR-599 stem-loop
Gene family MIPF0000502; mir-599
Stem-loop
   cu      a    --         u       gg     a  uu 
5'   guccag gugu  guuugauaa cugacau  gacag gg  c
     |||||| ||||  ||||||||| |||||||  ||||| ||   
3'   uagguc caua  caaacuauu gacugug  uuguc cu  u
   --      -    cc         u       --     a  uu 
Get sequence
Deep sequencing
786 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 364601260-364601342 [-]
antisense
ENSMODT00000008123 ; VPS13B-201; intron 29
Clustered miRNAs
< 10kb from mdo-mir-599
mdo-mir-875chr3: 364601417-364601491 [-]
mdo-mir-599chr3: 364601260-364601342 [-]
Database links

Mature sequence mdo-miR-599-5p

Accession MIMAT0026948
Sequence

15 - 

uuugauaaucugacaugggacag

 - 37

Get sequence
Deep sequencing782 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-599-3p

Accession MIMAT0012765
Sequence

52 - 

guugugucaguuuaucaaac

 - 71

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).