Stem-loop sequence mdo-mir-551b

AccessionMI0012521 (change log)
DescriptionMonodelphis domestica miR-551b stem-loop
Gene family MIPF0000360; mir-551
Stem-loop
   --    a         g      ga a   -cgu  g 
5'   cccc gaaaucaag augggu  g ccu    gu c
     |||| ||||||||| ||||||  | |||    ||  
3'   gggg cuuugguuc uaccca  c gga    ca a
   uc    a         a      -g -   aagu  a 
Get sequence
Deep sequencing
1142 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 234027689-234027759 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-551b
mdo-mir-551cchr7: 234027695-234027757 [+]
mdo-mir-551bchr7: 234027689-234027759 [-]
Database links

Mature sequence mdo-miR-551b-5p

Accession MIMAT0026947
Sequence

6 - 

gaaaucaaggaugggugagaccu

 - 28

Get sequence
Deep sequencing17 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-551b-3p

Accession MIMAT0012764
Sequence

46 - 

gcgacccauacuugguuucag

 - 66

Get sequence
Deep sequencing1125 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).