Stem-loop sequence mdo-mir-497

AccessionMI0012519 (change log)
DescriptionMonodelphis domestica miR-497 stem-loop
Gene family MIPF0000231; mir-497
Stem-loop
   cc    uc   c c    g    c         uu agu  u 
5'   ugcc  cgc c agca caca ugugguuug  c   gu a
     ||||  ||| | |||| |||| |||||||||  |   ||  
3'   augg  gcg g uugu gugu acaccaaac  g   cg u
   --    ga   a a    g    c         cu aac  g 
Get sequence
Deep sequencing
4764 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 255707663-255707746 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-497
mdo-mir-497chr2: 255707663-255707746 [+]
mdo-mir-195chr2: 255708032-255708103 [+]
Database links

Mature sequence mdo-miR-497-5p

Accession MIMAT0012762
Sequence

14 - 

cagcagcacacugugguuugu

 - 34

Get sequence
Deep sequencing4610 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-497-3p

Accession MIMAT0026946
Sequence

54 - 

caaaccacacugugguguuaga

 - 75

Get sequence
Deep sequencing154 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).