Stem-loop sequence mdo-mir-195

AccessionMI0012517 (change log)
DescriptionMonodelphis domestica miR-195 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   cc    cuuu        -aaa          ccugag  a 
5'   cugg    agcagcac    aauauuggca      gg a
     ||||    ||||||||    ||||||||||      ||  
3'   gauc    ucgucgug    uuaugaccgu      cc a
   --    ----        agag          -----a  g 
Get sequence
Deep sequencing
2835 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 255708032-255708103 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-195
mdo-mir-497chr2: 255707663-255707746 [+]
mdo-mir-195chr2: 255708032-255708103 [+]
Database links

Mature sequence mdo-miR-195

Accession MIMAT0012760
Sequence

10 - 

uagcagcacaaaaauauuggca

 - 31

Get sequence
Deep sequencing2826 reads, 5 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).