Stem-loop sequence mdo-mir-460

AccessionMI0012515 (change log)
DescriptionMonodelphis domestica miR-460 stem-loop
Gene family MIPF0000134; mir-460
Stem-loop
   c       -    aac ug       ca a        uuuc 
5'  ugacuuu auag   c  cauugua  c cugugugu    a
    ||||||| ||||   |  |||||||  | ||||||||     
3'  acugaga uauc   g  guaacau  g gacacgua    u
   c       a    aua gu       ac c        cccu 
Get sequence
Deep sequencing
17676 reads, 240 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 197334847-197334931 [-]
sense
ENSMODT00000017785 ; PTH1R-201; intron 9
Database links

Mature sequence mdo-miR-460-5p

Accession MIMAT0012758
Sequence

15 - 

ccugcauuguacacacugugug

 - 36

Get sequence
Deep sequencing17143 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-460-3p

Accession MIMAT0026945
Sequence

51 - 

cacagcgcauacaauguggaua

 - 72

Get sequence
Deep sequencing532 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).