Stem-loop sequence mdo-mir-33

AccessionMI0012511 (change log)
DescriptionMonodelphis domestica miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   --------          a uu          u g g 
5'         ggugcauugu g  gcauugcacg c u u
           |||||||||| |  |||||||||| | |  
3'         cuacgugaca c  uguaacgugc g g c
   cggagacc          c uu          c g c 
Get sequence
Deep sequencing
1493 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001583721.1: 291985-292052 [+]
intergenic
Database links

Mature sequence mdo-miR-33-5p

Accession MIMAT0012754
Sequence

2 - 

gugcauuguaguugcauugca

 - 22

Get sequence
Deep sequencing1405 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-33-3p

Accession MIMAT0026944
Sequence

42 - 

aauguuuccacagugcaucc

 - 61

Get sequence
Deep sequencing64 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).