Stem-loop sequence mdo-mir-499

AccessionMI0012510 (change log)
DescriptionMonodelphis domestica miR-499 stem-loop
Gene family MIPF0000173; mir-499
Stem-loop
   gggc   c      ua       ca          auucu 
5'     ggg agcugu  agacuug  gugauguuua     u
       ||| ||||||  |||||||  ||||||||||     c
3'     ccc uugaca  ucugaac  cacuacaagu     u
   ----   u      ua       aa          guauc 
Get sequence
Deep sequencing
24759 reads, 240 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 388424206-388424284 [+]
sense
ENSMODT00000003192 ; MYH7B-201; 3'UTR (exon 17)
Database links

Mature sequence mdo-miR-499-5p

Accession MIMAT0012753
Sequence

14 - 

uuaagacuugcagugauguuu

 - 34

Get sequence
Deep sequencing24610 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-499-3p

Accession MIMAT0026943
Sequence

52 - 

acaucacaacaagucuauaca

 - 72

Get sequence
Deep sequencing148 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).