Stem-loop sequence mdo-mir-455

AccessionMI0012509 (change log)
DescriptionMonodelphis domestica miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   -u  c   c ug  g          u      a   c   gaa 
5'   cc ugg g  ag guaugugccc uggacu cau gug   g
     || ||| |  || |||||||||| |||||| ||| |||    
3'   gg acu c  uc cauauacggg accuga gua cac   c
   uu  a   c gu  a          u      c   c   aac 
Get sequence
Deep sequencing
369 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 451465629-451465715 [-]
sense
ENSMODT00000004972 ; COL27A1-201; intron 11
Database links

Mature sequence mdo-miR-455-5p

Accession MIMAT0012752
Sequence

16 - 

uaugugcccuuggacuacaucg

 - 37

Get sequence
Deep sequencing229 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-455-3p

Accession MIMAT0026942
Sequence

52 - 

augcaguccaugggcauauaca

 - 73

Get sequence
Deep sequencing140 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).