Stem-loop sequence mdo-mir-210

AccessionMI0012507 (change log)
DescriptionMonodelphis domestica miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   -    cc   g  g    a   acua       u  c - u 
5'  ccgg  gca gg agcc cug    acgcaca ug g c c
    ||||  ||| || |||| |||    ||||||| || | |  
3'  ggcc  cgu cc ucgg gac    ugcgugu ac c g a
   c    aa   g  a    c   agug       c  c a g 
Get sequence
Deep sequencing
1488 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001584700.1: 16418-16499 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-210
mdo-mir-210NW_001584700.1: 16418-16499 [+]
mdo-mir-210bNW_001584700.1: 16429-16486 [-]
Database links

Mature sequence mdo-miR-210-5p

Accession MIMAT0026941
Sequence

14 - 

agccacugacuaacgcacauug

 - 35

Get sequence
Deep sequencing151 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-210-3p

Accession MIMAT0012750
Sequence

48 - 

acugugcgugugacagcggcu

 - 68

Get sequence
Deep sequencing1337 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).