Stem-loop sequence mdo-mir-205a

AccessionMI0012506 (change log)
DescriptionMonodelphis domestica miR-205a stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
   -------     c           c        ucuca 
5'        cuugu cuucauuccac ggagucug     u
          ||||| ||||||||||| ||||||||     a
3'        gaaua gaagugaggug cuuuagac     u
   guacgga     c           a        uaauc 
Get sequence
Deep sequencing
129 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 116544495-116544566 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-205a
mdo-mir-205achr2: 116544495-116544566 [+]
mdo-mir-205bchr2: 116544497-116544554 [-]
Database links

Mature sequence mdo-miR-205a

Accession MIMAT0012749
Sequence

5 - 

uccuucauuccaccggagucug

 - 26

Get sequence
Deep sequencing129 reads, 4 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).