Stem-loop sequence mdo-mir-153-1

AccessionMI0012505 (change log)
DescriptionMonodelphis domestica miR-153-1 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   c     g         -             -c       --   au 
5'  ucaca cugccagug ucauuuuugugau  ugcagcu  agu  u
    ||||| ||||||||| |||||||||||||  |||||||  |||   
3'  ggugu gacgguuac agugaaaacacug  acguuga  ucg  c
   c     g         u             au       cu   gu 
Get sequence
Deep sequencing
15187 reads, 200 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 173335344-173335433 [+]
sense
ENSMODT00000037682 ; PTPRN-201; intron 19
Database links

Mature sequence mdo-miR-153-1-5p

Accession MIMAT0031108
Sequence

17 - 

ucauuuuugugaucugcagcu

 - 37

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-153-3p

Accession MIMAT0012738
Sequence

54 - 

uugcauagucacaaaagugauc

 - 75

Get sequence
Deep sequencing30354 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).