Stem-loop sequence mdo-mir-150

AccessionMI0012504 (change log)
DescriptionMonodelphis domestica miR-150 stem-loop
Gene family MIPF0000197; mir-150
Stem-loop
   uc    a  -      --a   g     --   aga 
5'   uccc ac ccuugu   cca agucc  auc   g
     |||| || ||||||   ||| |||||  |||    
3'   gggg ug ggggca   ggu ucggg  ugg   a
   uc    c  a      ggg   g     ca   ccc 
Get sequence
Deep sequencing
2063 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 412972134-412972202 [+]
sense
ENSMODT00000031346 ; AKT1S1-201; intron 5
antisense
ENSMODT00000017114 ; RPS11-201; 3'UTR (exon 5)
Database links

Mature sequence mdo-miR-150-5p

Accession MIMAT0012748
Sequence

1 - 

ucucccaacccuuguaccagagu

 - 23

Get sequence
Deep sequencing1916 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-150-3p

Accession MIMAT0026940
Sequence

35 - 

ccgguacgggcugugggggacg

 - 56

Get sequence
Deep sequencing147 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).