Stem-loop sequence mdo-mir-146b

AccessionMI0012503 (change log)
DescriptionMonodelphis domestica miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   cugg    g        a    a    cu  ga  u 
5'     cucu agaacuga uucc uagg  gu  gc c
       |||| |||||||| |||| ||||  ||  ||  
3'     gagg ucuugacu aagg aucc  ua  cg a
   ----    -        g    -    cg  aa  u 
Get sequence
Deep sequencing
151038 reads, 2.38e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 109630336-109630403 [-]
intergenic
Database links

Mature sequence mdo-miR-146b-5p

Accession MIMAT0012747
Sequence

8 - 

ugagaacugaauuccauaggcu

 - 29

Get sequence
Deep sequencing150765 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-146b-3p

Accession MIMAT0026939
Sequence

48 - 

ccuaggaagucaguucugga

 - 67

Get sequence
Deep sequencing273 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).